v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus caroli (Ryukyu mouse) microRNA 5710 (MGP_CAROLIEiJ_G0008272.1) URS000075E068_10089

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGUCUUGGGACAUAGUGUAAGGCAGUGGUCUGGCUAGUCCCACUAACUGGCUCUUUGUCCCUCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Mus musculus microRNA mmu-mir-5710 precursor
  2. Mus spicilegus (steppe mouse) microRNA 5710 (ENSMSIG00000004053.1)
  3. Mus spretus microRNA 5710 (MGP_SPRETEiJ_G0008710.1)