v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33730379 URS000075DFD0_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAGGAAGUGUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Anolis carolinensis (green anole) aca-miR-206-3p
  2. Monodelphis domestica mdo-miR-206
  3. Oryzias latipes ola-miR-206
  4. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-5157539