Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-153b-5p URS000075DD05_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAUUUUUGUGAUGUUGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Cavia porcellus cpo-miR-153-5p
  2. Columba livia cli-miR-153b-5p
  3. Danio rerio dre-miR-153a-5p
  4. Ophiophagus hannah oha-miR-153-1-5p
  5. Oryctolagus cuniculus (rabbit) ocu-miR-153-5p
  6. Pteropus alecto (black flying fox) pal-miR-153-5p
  7. Python bivittatus pbv-miR-153-5p
  8. Rattus norvegicus (Norway rat) rno-miR-153-5p
  9. Taeniopygia guttata (zebra finch) tgu-miR-153-1-5p