Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000021913.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000021913.1) URS000075DAB3_9739

82 nucleotides
1 database (Ensembl)
Found in 9 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUUACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCACUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Balaenoptera musculus microRNA 103a-1 (ENSBMSG00010009372.1)
Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000015413.1)
Delphinapterus leucas microRNA 103a-1 (ENSDLEG00000012266.1)
Monodon monoceros (narwhal) microRNA 103a-1 (ENSMMNG00015006335.1)
Moschus moschiferus (Siberian musk deer) microRNA 103a-1 (ENSMMSG00000018665.1)
Phocoena sinus microRNA 103a-1 (ENSPSNG00000009520.1)
Physeter catodon (sperm whale) microRNA 103a-1 (ENSPCTG00005001515.1)
Sus scrofa (pig) microRNA ssc-mir-103 precursor (ssc-mir-103-1)

2D structure