Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anas platyrhynchos platyrhynchos (common mallard) microRNA 196b (ENSAPLG00000000450.2) URS000075D9D4_8840

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUGCUCUGUGGUUUAGGUAGUUUCAUGUUGUUGGGGCUCCACCUUUCUCUCUACAGCACGAAACUGCCUUAAUUACUUCAGUUGAUAUCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Accipiter nisus (Eurasian sparrowhawk) microRNA 196b (ENSANIG00000017316.1)
  2. Anas platyrhynchos (mallard) microRNA 196b (ENSAPLG00020001004.1)
  3. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000012280.1)
  4. Anser brachyrhynchus microRNA 196b (ENSABRG00000010213.1)
  5. Apteryx owenii (little spotted kiwi) microRNA 196b (ENSAOWG00000006323.1)
  6. Apteryx rowi (Okarito brown kiwi) miRNA (ENSARWG00000010811.1)
  7. Aquila chrysaetos chrysaetos microRNA 196b (ENSACCG00020008177.1)
  8. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000002700.1)
  9. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000004733.1)
  10. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000008718.1)
  11. Camarhynchus parvulus (small tree finch) miRNA (ENSCPVG00000003375.2)
  12. Catharus ustulatus (Swainson's thrush) miRNA (ENSCUSG00005004391.1)
  13. Corvus moneduloides (New Caledonian crow) miRNA (ENSCMUG00000011522.2)
  14. Coturnix japonica (Japanese quail) microRNA 196b (ENSCJPG00005012533.1)
  15. Cyanoderma ruficeps microRNA 196b (ENSCRFG00000005716.1)
  16. Chloebia gouldiae miRNA (ENSEGOG00005002631.1)
  17. Falco tinnunculus miRNA (ENSFTIG00000012029.1)
  18. Ficedula albicollis (Collared flycatcher) microRNA 196b (ENSFALG00000015663.2)
  19. Gallus gallus microRNA gga-mir-196 precursor (gga-mir-196-2, gga-mir-196-4, gga-mir-196-5)
  20. Junco hyemalis (dark-eyed junco) microRNA 196b (ENSJHYG00000005786.1)
  21. Lepidothrix coronata microRNA 196b (ENSLCOG00000001687.1)
  22. Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000000787.1)
  23. Malurus cyaneus samueli miRNA (ENSMCSG00000007552.1)
  24. Manacus vitellinus (golden-collared manakin) miRNA (ENSMVIG00005017590.1)
  25. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000007190.2)
  26. Numida meleagris microRNA 196b (ENSNMEG00000007773.1)
  27. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000004999.1)
  28. Parus major (Great Tit) microRNA 196b (ENSPMJG00000001486.1)
  29. Pavo cristatus (Indian peafowl) microRNA 196b (ENSPSTG00000018430.1)
  30. Serinus canaria (common canary) microRNA 196b (ENSSCAG00000015056.1)
  31. Strix occidentalis caurina miRNA (ENSSOCG00000003744.1)
  32. Struthio camelus australis (African ostrich) microRNA 196b (ENSSCUG00000006919.1)
  33. Taeniopygia guttata (zebra finch) microRNA 196b (ENSTGUG00000018032.2)
  34. Zonotrichia albicollis miRNA (ENSZALG00000011306.1)
  35. Zosterops lateralis melanops microRNA 196b (ENSZLMG00000004130.1)
Publications