Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Erythrura gouldiae (Gouldian finch) miRNA (ENSEGOG00005002231.1) URS000075D8EA_44316

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAGCUCUUGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUCACUAAUCUACUGCAUUAUAAGCACUUAAAGUACUGCUAGCUGUAGAACUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Amazona collaria microRNA 20a (ENSACOG00000009371.1)
  2. Calidris pugnax microRNA 20a (ENSCPUG00000016348.1)
  3. Calidris pygmaea microRNA 20a (ENSCPGG00000011130.1)
  4. Catharus ustulatus (Swainson's thrush) miRNA (ENSCUSG00005010957.1)
  5. Chrysolophus pictus microRNA 20a (ENSCPIG00010009474.1)
  6. Corvus moneduloides (New Caledonian crow) miRNA (ENSCMUG00000003962.2)
  7. Coturnix japonica (Japanese quail) microRNA 20a (ENSCJPG00005019434.1)
  8. Cyanistes caeruleus microRNA 20a (ENSCCEG00000000395.1)
  9. Cyanoderma ruficeps microRNA 20a (ENSCRFG00000011364.1)
  10. Falco tinnunculus miRNA (ENSFTIG00000002915.1)
  11. Ficedula albicollis (Collared flycatcher) microRNA 20a (ENSFALG00000015745.2)
  12. Gallus gallus microRNA gga-mir-20a precursor
  13. Junco hyemalis (dark-eyed junco) microRNA 20a (ENSJHYG00000010595.1)
  14. Lepidothrix coronata miRNA (ENSLCOG00000006345.1, ENSLCOG00000014655.1)
  15. Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000014132.1)
  16. Malurus cyaneus samueli miRNA (ENSMCSG00000012346.1)
  17. Manacus vitellinus (golden-collared manakin) miRNA (ENSMVIG00005011777.1)
  18. Meleagris gallopavo (turkey) microRNA 20a (ENSMGAG00000000422.2)
  19. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000012788.2)
  20. Numida meleagris microRNA 20a (ENSNMEG00000020424.1)
  21. Phasianus colchicus microRNA 20a (ENSPCLG00000013807.1)
  22. Serinus canaria (common canary) microRNA 20a (ENSSCAG00000015857.1)
  23. Strigops habroptila microRNA 20a (ENSSHBG00005010532.1)
  24. Taeniopygia guttata (zebra finch) microRNA 20a (ENSTGUG00000017904.2)
  25. Zonotrichia albicollis miRNA (ENSZALG00000008449.1)
  26. Zosterops lateralis melanops microRNA 20a (ENSZLMG00000000632.1)