Sinocyclocheilus rhinocerous (horned golden-line barbel) miRNA (ENSSRHG00000046694.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sinocyclocheilus rhinocerous (horned golden-line barbel) miRNA (ENSSRHG00000046694.1) URS000075D866_307959

87 nucleotides
1 database (Ensembl)
Found in 7 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCCUGCUCCGUCAUCCCAGUGUUCAGACUACCUGUUCAGGAUCAUACUGGUGUACAGUAGUCUGCACAUUGGUUAGACUGUGCAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Carassius auratus microRNA 199a-2 (ENSCARG00000038793.1, ENSCARG00000057099.1)
Danio rerio microRNA dre-mir-199 precursor (dre-mir-199-1)
Ictalurus punctatus (channel catfish) microRNA 199a-1 (ENSIPUG00000012967.1)
Pygocentrus nattereri (red-bellied piranha) miRNA (ENSPNAG00000029587.1)
Sinocyclocheilus anshuiensis miRNA (ENSSANG00000018404.1, ENSSANG00000032927.1)
Sinocyclocheilus grahami miRNA (ENSSGRG00000004206.1, ENSSGRG00000006852.1, ENSSGRG00000035462.1)