Equus caballus (horse) microRNA 374b (ENSECAG00000025706.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) microRNA 374b (ENSECAG00000025706.2) URS000075D764_9796

80 nucleotides
1 database (Ensembl)
Found in 2 other species
17 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAUCAGGUUGUAUUAUCAUUGUCCGUGUCUAUGGCUCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Equus asinus asinus miRNA (ENSEASG00005003112.1)
Equus asinus (ass) microRNA 374b (ENSEASG00005003112.2)
Sus scrofa (pig) microRNA ssc-mir-374b precursor

Publications