v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR181A1 host gene (MIR181A1HG) URS000075D647_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR181A1HG: MIR181A1HG is a nuclear RNA [PMC9095685]. Knockdown of MIR181A1HG resulted in higher expression levels of 884 protein-coding genes, which were associated with various biological processes [PMC9095685]. These processes include collagen fibril and extracellular matrix (ECM) organization, bone development and ossification, regulation of ERK and MAPK signaling, regulation of cell proliferation, and regulation of cell death [PMC9095685].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAACUGCAGAUAGUACAGCUUCCACAGGAGCAAGGGAUGUCUGAGCACAAGUGGCUGAGUUCCGAGUGACUUUAUGAAGCACUUUCUACCUUCCUCUCCGGCAUGAAAACAGGGAUUCUGCACCUGCAUCAUGGACAGUCUGGCAAAAGCCUCUGCUCUGCCUCCGGGGACAAGAAACUAGAGCAAAUAACCGUUUUGAAAUUAGAUCCUGGCAAAAUUACCAACAAUCAAUGAUGGAAACUGAAGGGAGAUUGAUUUAAAUCUUCAAUGACAGUUGUACAGAAGUUGAAGAAACACGUCAUCUUUCCAAAGAAGAGUGAGUAGCUUGGUUGGUGGUACCCUAAAAUUAGGGCAUGAUUAAGGUCUCGCUCUGCCACCCAGGCUAGGAGUGCAGUAGAGUGACUACAGUUCACAGCAGACUCAACCUUCCAGGCUCAAGCAAUCCUCUCACCUCGGCCUCCCAAGUACCUGGGACUACAGGCACACUCCACCAUUCCCAGCUAAUUUUUGUAUUUUUUGUAGAGACAUGGUUUUGACAUAUUGUCCAGGCUGGUCUUUUACUGUCAAAUUGCUAUAUUUUAUUGCUUUUGUUUUUGAAUAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications