v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CA3 antisense RNA 1 (CA3-AS1) URS000075D522_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CA3-AS1: CA3-AS1 is a long non-coding RNA (lncRNA) that has been identified as a key player in gastrointestinal cancers [PMC8965071]. It has been found to have a ceRNA (competing endogenous RNA) regulator function in gastric cancer, where it acts as an anti-oncogene by sponging hsa-miR-93-5p [PMC8965071]. In patients with visceral leishmaniasis (VL), CA3-AS1 is upregulated compared to the non-diseased group [PMC8965071]. However, there is no literature associating CA3-AS1 with plasma or circulating exosomes [PMC8965071]. CA3-AS1 interacts with hsa-miR-93-5p, which targets the NEDD4L protein and the transcriptional repressor MXI1. These three molecules are upregulated during L. infantum infection [PMC8965071]. In a risk score calculation for irlncRNAs, CA3-AS1 was found to have an expression that contributes positively to the risk score in patients [PMC9008733]. CA3-AS1 and IRF1-AS1 were found to be downregulated in the serum of patients with active visceral leishmaniasis compared to controls [PMC9845402]. Functionally, CA3-AS1 has been implicated in immune response and acts as a sponge for miR-93 [PMC9845402][PMC8531750][PMC7325196][PMC10114484]. It has also been shown to restrain colorectal cancer cell survival and invasion by targeting miR-93/PTEN axis [PMC9330462][PM8531750][PM7325196]. Word count: 200 words

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAUGCAAGCUCACUUAAGACAUUCAAGGAGGUCUGGAUCCUUUCCUCACUGCCCAGGCCCGGGCCCACCCCACCUUUAACCGUCAGGGUUCCCCACUACCUGGGAAGCCCCACACCCUCCAAAGAUGCGCUAGGUGCGCCAGACGCAUGCUCCUCUGCUCCGCUGGCUCCGAAGAACCAGAUCUGAGGCCAAGAUAAAACCCGAUUCCUGAUGUCCGACCCCCUAACAUUAGAAGUCGAGAGAUGAAGGGAAAACUCGGAAAUCAGAGCCAUGGAUUCAAACCAGCACUGGAAAAUGCCCCGGGACAGUUCGUGCUGAGCGCCUUAGCCACAGGAAACAUUUUCCUGGGCAUCUAAAAGUAUUGUGGACCUGAGACACUGUGCUUACAGGGCCUACUGGUUUUCACUGUAUGAGACCGAGAAUGGAUUAUGGCAGUUCCUCUUACCUCCGCUGCAUACUUGACUCCAUCCACGGUGUGCUCAGAGCCAUGAUCAUCCGAAGAGCCCCAGUGAAGAUGAAACUGGCGAAGUCGGUAGGGUCCAGGGAGAGGACCCCCUCUCAGCACUGUGAUUCAGAUAAGCUUGGUCAACAGUGAAUUCAUGCUUCUUUUACAGAGCUCUACUUUAACCAAGUGCUCUUAGAGCCAAGGCUUAAUGGACAAAAUGUGGUCAGUUUGCUGGGUGGAUGGUGCCACUCCCAGGACACUGGACUCCUCACAAAAUGAAGUCUGGGGAUAUGUCAAGAUAAAUGAUUGUUCUUUUCUGUCUUUCUUAUUUUGUUUGCUUGUUUCAUUAUUAUUGAAACAUCAUUUUAACAUUUAGGAAAGCAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications