Mus pahari (Shrew mouse) microRNA 2861 (MGP_PahariEiJ_G0007325.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus pahari (Shrew mouse) microRNA 2861 (MGP_PahariEiJ_G0007325.1) URS000075D489_10093

82 nucleotides
1 database (Ensembl)
Found in 3 other species
7 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUCCUCUGCAGCUCCGGCUCCCCCUGGCCUCCCGGGAACUACAAGUCCCAGGGGGCCUGGCGGCGGGCGGAGACCGGAAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Mus musculus microRNA mmu-mir-2861 precursor
Mus spretus (algerian mouse) microRNA 2861 (MGP_SPRETEiJ_G0008097.1)
Rattus norvegicus microRNA 2861 (ENSRNOG00000049532.2)

2D structure

Publications