Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (bonobo) microRNA 30c-1 (ENSPPAG00000018473.1) secondary structure diagram

Pan paniscus (bonobo) microRNA 30c-1 (ENSPPAG00000018473.1) URS000075D43C_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAUGCUGUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGAGCUCAAGGUGGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000005871.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000025962.3)
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 30c-1 (ENSCCAG00000007833.1)
  4. Cercocebus atys miRNA (ENSCATG00000021903.1)
  5. Choloepus hoffmanni (Hoffmann's two-fingered sloth) microRNA 30c-1 (ENSCHOG00000015442.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000016262.1)
  7. Dasypus novemcinctus (nine-banded armadillo) microRNA 30c-1 (ENSDNOG00000047698.1)
  8. Equus asinus asinus microRNA 30c-1 (ENSEASG00005001058.1)
  9. Equus asinus (ass) microRNA 30c-1 (ENSEASG00005001058.2)
  10. Equus caballus (horse) microRNA eca-mir-30c precursor
  11. Gorilla gorilla gorilla microRNA 30c-1 (ENSGGOG00000031846.2)
  12. Homo sapiens microRNA hsa-mir-30c precursor (hsa-mir-30c-1)
  13. Loxodonta africana (African savanna elephant) microRNA 30c-1 (ENSLAFG00000023467.1)
  14. Macaca fascicularis microRNA 30c-1 (ENSMFAG00000017252.2)
  15. Macaca mulatta microRNA mml-mir-30c precursor (mml-mir-30c-1)
  16. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000006234.1)
  17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000019593.1)
  18. Microcebus murinus (gray mouse lemur) microRNA 30c-1 (ENSMICG00000017952.3)
  19. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 30c-1 (ENSNLEG00000025204.2)
  20. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000018100.1)
  21. Pan troglodytes ptr-mir-30c-1 (ENSPTRG00000027608.2)
  22. Papio anubis miRNA (ENSPANG00000006717.3)
  23. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 30c-1 (ENSPTEG00000030204.1)
  24. Pongo abelii microRNA 30c-1 (ENSPPYG00000021726.2)
  25. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-30c precursor (ppy-mir-30c-1)
  26. Prolemur simus microRNA 30c-1 (ENSPSMG00000016668.1)
  27. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000009632.1)
  28. Pteropus vampyrus (large flying fox) microRNA 30c-1 (ENSPVAG00000026652.1)
  29. Rhinopithecus bieti miRNA (ENSRBIG00000014022.1)
  30. Rhinopithecus roxellana microRNA 30c-1 (ENSRROG00000008673.1)
  31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000000999.1)
  32. Theropithecus gelada (gelada) microRNA 30c-1 (ENSTGEG00000024326.1)
2D structure Publications