v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 1204 (ENSPTEG00000030875.1) secondary structure diagram

Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 1204 (ENSPTEG00000030875.1) URS000075D2B1_591936

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCUCGUGGCCUGGUCUCCAUUAUUUGAGAUGAGUUACAUCUUGGAGGUGAGGACGUGCCUCGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cercocebus atys microRNA 1204 (ENSCATG00000042805.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 1204 (ENSCSAG00000026931.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000019673.1)
  4. Gorilla gorilla gorilla microRNA 1204 (ENSGGOG00000032789.2)
  5. Homo sapiens microRNA hsa-mir-1204 precursor
  6. Macaca fascicularis microRNA 1204 (ENSMFAG00000012302.2)
  7. Macaca mulatta microRNA 1204 (ENSMMUG00000034106.3)
  8. Macaca nemestrina (Pig-tailed macaque) microRNA 1204 (ENSMNEG00000002737.1)
  9. Mandrillus leucophaeus (Drill) microRNA 1204 (ENSMLEG00000013735.1)
  10. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1204 (ENSNLEG00000025693.2)
  11. Papio anubis microRNA 1204 (ENSPANG00000014810.3)
  12. Pongo abelii microRNA 1204 (ENSPPYG00000023447.2)
  13. Rhinopithecus bieti microRNA 1204 (ENSRBIG00000008822.1)
  14. Rhinopithecus roxellana microRNA 1204 (ENSRROG00000003148.1)
  15. Theropithecus gelada (gelada) microRNA 1204 (ENSTGEG00000010798.1)
 2D structure