Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4257 precursor URS000075D1D5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4257: Hsa-mir-4257 is a microRNA that is downregulated in mild COVID-19 cases compared to healthy controls and further downregulated in severe COVID-19 cases compared to mild cases [PMC8625524]. It has been identified as an independent prognostic factor for COVID-19 severity, along with other factors such as LncRNA RP11-773H22.4, IL11RA mRNA, and IL11RA protein levels [PMC8625524]. Hsa-mir-4257 has shown better sensitivity in predicting COVID-19 severity compared to ferritin and procalcitonin [PMC8625524]. SARS-CoV-2 infection leads to the upregulation of LncRNA RP11-773H22.4, which in turn downregulates hsa-mir-4257 and upregulates IL11RA mRNA [PMC8625524]. Hsa-mir-4257 is negatively correlated with IL11RA mRNA expression [PMC8625524]. It has been found to be discriminatory between COVID-19-positive patients and healthy controls, as well as between mild and severe cases of COVID-19 [PMC8625524]. In the context of T1D, hsa-mir-4257 has been identified as a potential biomarker associated with the development of the disease along with other genes such as PRKACA, DSP, RGS4, FOXD1, EYA1, TFAP2A, and GAB2 [PMC8028841]. In addition, hsa-mir-4257 has been found to have a binding site on Omicron's Spike NTD due to a stretch of nucleotide insertion [PMC9721271]. Treatment with ß-methyl-digoxin leads to the downregulation of hsa-mir-4257 [PMC5355295].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUUAGAAACAGUCCCUAGGUAGGAUUUGGGGAGGAGCUAAGAAGCCCCUACAGGGCCCAGAGGUGGGGACUGAGCCUUAGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications