Mandrillus leucophaeus (Drill) microRNA 4667 (ENSMLEG00000002127.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mandrillus leucophaeus (Drill) microRNA 4667 (ENSMLEG00000002127.1) URS000075D106_9568

66 nucleotides
1 database (Ensembl)
Found in 8 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGACUGGGGAGCAGAAGGAGAACCCAAGAAAAGCUGACUUGGAGGUCCCUCCUUCUGUCCCCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Colobus angolensis palliatus miRNA (ENSCANG00000005075.1)
Gorilla gorilla gorilla microRNA 4667 (ENSGGOG00000042253.1)
Homo sapiens microRNA hsa-mir-4667 precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 4667 (ENSMNEG00000006536.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 4667 (ENSNLEG00000033999.1)
Pan paniscus (bonobo) microRNA 4667 (ENSPPAG00000002197.1)
Pan troglodytes microRNA mir-4667 (ENSPTRG00000040328.2)
Pongo abelii miRNA

2D structure