Oreochromis niloticus (Nile tilapia) oni-miR-130b-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oreochromis niloticus (Nile tilapia) oni-miR-130b-3p URS000075D0FF_8128

22 nucleotides
1 database (miRBase)
Found in 5 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAGUGCAAUAAUGAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Cyprinus carpio (common carp) ccr-miR-130b
Danio rerio dre-miR-130b
Ophiophagus hannah oha-miR-130d
Python bivittatus Pbv-Mir-130-P4a_3p (mature (guide))
Tor tambroides miR-130b