Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1973 precursor URS000075D0D5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1973: MIR1973 is a microRNA that is involved in various biological processes. It has been found to be associated with the translocation associated membrane protein 1-like 1 (TRAM1L1) gene [PMC4852408]. The expression pattern of MIR1973 in alveolar type II (ATII) cells from emphysema patients and controls was similar to that of 16S rRNA, suggesting a direct link between MIR1973 and long non-coding RNAs (lncRNAs) [PMC9313339]. The levels of MIR1973 and miR4485-3p, which are partially derived from MT-RNR2 gene transcripts, were analyzed [PMC9313339]. Increased levels of MIR1973 were found in patients with chronic obstructive pulmonary disease (COPD) compared to smokers [PMC9313339]. In emphysema, the expression of MIR1973 was decreased in ATII cells compared to smokers and was lower in nonsmokers than in smokers [PMC9313339]. In a dataset analysis, MIR1973 was not represented [PMC7425458]. CpGs within 10,000 bp of a gene were identified, including two CpGs mapped to NLRC5 and MIR1973 within 1,500 bp of transcription start sites [PMC7425458]. Furthermore, the expression of MIR1973 has been shown to increase resistance in lung adenocarcinoma cells with subsequent low apoptosis intensity [PMC7425458].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUUCAACGGCCAUGGUAUCCUGACCGUGCAAAGGUAGCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes miRNA
  2. Pongo abelii miRNA
Publications