Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 485 (ENSGGOG00000034781.2) secondary structure diagram

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 485 (ENSGGOG00000034781.2) URS000075D081_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 485 (ENSANAG00000013189.1)
  2. Camelus ferus (Wild Bactrian camel) mir-485 microRNA precursor family
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 485 (ENSCCAG00000015927.1)
  4. Cercocebus atys microRNA 485 (ENSCATG00000015441.1)
  5. Chlorocebus sabaeus mir-485 microRNA precursor family
  6. Colobus angolensis palliatus miRNA (ENSCANG00000037865.1)
  7. Eptesicus fuscus (big brown bat) mir-485 microRNA precursor family
  8. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000000135.1)
  9. Gorilla gorilla (western gorilla) mir-485 microRNA precursor family
  10. Homo sapiens microRNA hsa-mir-485 precursor
  11. Jaculus jaculus miRNA (ENSJJAG00000000688.1)
  12. Macaca mulatta microRNA mml-mir-485 precursor
  13. Macaca nemestrina (Pig-tailed macaque) microRNA 485 (ENSMNEG00000002055.1)
  14. Mandrillus leucophaeus (Drill) microRNA 485 (ENSMLEG00000012956.1)
  15. Microcebus murinus (gray mouse lemur) microRNA 485 (ENSMICG00000019372.3)
  16. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000020369.1)
  17. Myotis brandtii mir-485 microRNA precursor family
  18. Myotis davidii mir-485 microRNA precursor family
  19. Myotis lucifugus microRNA 485 (ENSMLUG00000018093.1)
  20. Nannospalax galili miRNA (ENSNGAG00000002283.1)
  21. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 485 (ENSNLEG00000023958.2)
  22. Otolemur garnettii (small-eared galago) microRNA 485 (ENSOGAG00000017267.1)
  23. Pan paniscus (bonobo) microRNA 485 (ENSPPAG00000007471.1)
  24. Pan troglodytes ptr-mir-485 (ENSPTRG00000027560.3)
  25. Papio anubis (Olive baboon) mir-485 microRNA precursor family
  26. Pongo abelii mir-485 microRNA precursor family
  27. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-485 precursor
  28. Propithecus coquereli (Coquerel's sifaka) microRNA 485 (ENSPCOG00000008092.1)
  29. Rhinopithecus bieti microRNA 485 (ENSRBIG00000008076.1)
  30. Rhinopithecus roxellana microRNA 485 (ENSRROG00000002630.1)
  31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 485 (ENSSBOG00000019041.1)
  32. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016571.1)
2D structure Publications