v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1119 (LINC01119) URS000075CEA4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01119: LINC01119 is an evolutionarily conserved long non-coding RNA (lncRNA) that is expressed during mesenchymal stem cell (MSC) osteogenic differentiation [PMC8800246]. Two lncRNAs, LINC01119 and LINC02447, have been found to be directly involved in the pain pathway and may have significance in neuropathic pain [PMC8255623]. It is proposed that LINC01119 induces the expression of SOCS5, which then inhibits STAT6, leading to the suppression of tumor growth in triple-negative breast cancer (TNBC) cells [PMC8166834]. Furthermore, in cancer cells recovered from human bone marrow-derived MSC-containing xenografts, there was a significant increase in the expression of LINC01119 isoform 3 compared to controls [PMC8166834]. The highest fold change was observed for LINC01119 (FC = 4.35) [PMC6943368]. Previous studies have suggested that LINC01119 may be closely associated with neuropathic pain [PMC8255623].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACAUAAGUGUGAGUGACUCCUUACUGCCGUCCAGGCAGCCUGGGGGCUACGAGGGGCUUCAGAGGUCCUCAUCCCCAGCCUGUAGGCCUGGCCAUACUGGACCCAUGAGAUCAGCCACCCUGUCAGCUGGUACCUCGGGGUCCUACAGUCCUCCUCGCUCAAGCCCUGGUCCUCUAACUCGGAGGUGAUGAGGUGUUGGGCUGGAAGAGACAGGCAGCCAGAUGAUUCCAAUGUACAGCCAAUGAUGAGCAGCUGCUGGGCUGAAGGGACUGGGGCCAUUUUAUACCAGGAUGUUACACAGAAAUGCCUGAAAAGCAAGGAGCAGCUAUCAGAAUGUUUGGUGACACAGCUCCUCCUGUCGUGGUUCCUUCGGCAUGGACUUCACAUUCAGCAGAUCCAUGAGGUGUUCCCUUUCGGAUGAGCUCCAAGGUCUUAAGAGAGCAUCUCUAGUCUGCGUGAGUCCGUCUGAACGACGGUCCUGAGCAAGAACCACCUAUAACCAUCUGCUCAAAAUAACUCAGGGGAAGUCAAAGCUUUCUAUGUGGAAGGUGACUGAAACCACAUACACAGACCACUGCAGCAUUCCUGACAUUAUGGAACUUGGAAAUGAUUCCAAACAUGGCCAUAGCUUGAGUAACAUGUUUUGCUAUGACAAGAACUUGGACUGUAGUCCUUCCCCCUCUCAAGAAUGUGACAUCACACCUUAUCAGAUCCUACGAGUGAGCUACUGACCUCAACCACUGAACUUCAAACUAUGUAAAAACCUAAGGGUUCGACAGACACUUUGAGAGCUUGGGCUGUGGCAAGCUACACUCUGUCAGCCUCUCUUCGACAGGGCCCCACCCUGCUAGCCUUUGAACUUGGAAGCAUCGCCCACAAACACCAGUGCCACCCUCUAGCCUUGAGGGACCAUAUAUGUCUCUGUGAAUCUCCGUUGCAUUGGACAGCUUCUCUCCCAAGAGCUGCUCUUAUAAAAGAGACACACCACAUUUUAAUGAGGCUUCGCUCUCCACAGAGGCCUGCUUCCAUCCUAAUUGAGCAAGUAGACUUUAGUAACUUUGGAACUCACUCACCCCGUGACUAAUACACCCUGUCUACCCAGCGCAUUCCCUGUGAGAUUUGUUCAUGUUGUUCUCCCCCUCCUUAAGCAUUGUGAACCUAGGAAAAAUAUCAUCUCUGUAGGGCAAUAAACCAUGUGAUUUGUGAAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications