Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-143

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-143 URS000075CDFC_9417

22 nucleotides
1 database (miRBase)
Found in 7 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGAGAUGAAGCACUGUAGCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Bos taurus bta-miR-143
Capra hircus (goat) chi-miR-143-3p
Gallus gallus gga-miR-143-3p
Monodelphis domestica mdo-miR-143-3p
Mus musculus Mus_musculus piRNA piR-mmu-49040582
Tupaia chinensis tch-miR-143-3p
Xenopus tropicalis xtr-miR-143

Publications