v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 665 (ENSRROG00000000376.1) secondary structure diagram

Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 665 (ENSRROG00000000376.1) URS000075CD82_61622

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCCUCGAGGGGUCUCUGCCUCUACCCAGGACUCUUUCAUGACCAGGAGGCUGAGGCCCCUCACAGGCGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus microRNA mir-665
  2. Cercocebus atys miRNA (ENSCATG00000017598.1)
  3. Chlorocebus sabaeus (African green monkey) microRNA 665 (ENSCSAG00000025517.1)
  4. Colobus angolensis palliatus miRNA (ENSCANG00000015252.1)
  5. Homo sapiens microRNA hsa-mir-665 precursor
  6. Macaca mulatta microRNA mml-mir-665 precursor
  7. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000019540.1)
  8. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012414.1)
  9. Papio anubis (Olive baboon) microRNA mir-665
  10. Rhinopithecus bieti miRNA (ENSRBIG00000021629.1)
 2D structure