Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-122 precursor URS000075CD37_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-122: Rno-mir-122 is a microRNA that was used in a study to investigate its effects on injuries induced by CCl4 in animals [PMC9513290]. The study involved injecting animals with either rno-mir-122 mimic or a negative control [PMC9513290]. The serum levels of rno-mir-122, along with rno-miR-9a-5p and rno-miR-192-5p, increased significantly 8 hours after injection and reached peak levels at 24 hours before returning to baseline levels at 72 hours [PMC4366852]. The baseline levels of rno-mir-122 were low, indicating that it may serve as a housekeeping miRNA for the liver [PMC4366852] [PMC5465221]. Despite its abundant expression in the rat livers, there was no differential expression of rno-mir-122 compared to the control animals, suggesting that it may not be relevant to the treatment effects [PMC5465221]. However, it was found to be one of the top ten most abundant miRNAs in the livers across all treatment conditions [PMC5465221]. The microRNA levels were assessed using the TaqMan MicroRNA assay with specific primers for various mature miRNAs including rno-mir-122 [PMC3864878]. References: [PMC9513290] - Study on injuries induced by CCl4 and effects of rno-mir-122 mimic: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9513290/ [PMC4366852] - Study on serum levels of various miRNAs including rno-miR9a5p and rnomiR1925p: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4366852/ [PMC5465221] - Study on differential expression and relevance of rno-mir-122: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5465221/ [PMC3864878] - Study on microRNA levels using TaqMan MicroRNA assay: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3864878/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUAGCAGAGCUCUGGAGUGUGACAAUGGUGUUUGUGUCCAAAACAUCAAACGCCAUCAUCACACUAAACAGCUACUGCUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications