v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) EPB41L4A antisense RNA 1 (EPB41L4A-AS1) URS000075CCBD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

EPB41L4A-AS1: EPB41L4A-AS1 is a long non-coding RNA (lncRNA) that promotes the proliferation, migration, and invasion of osteosarcoma cells partly via miR-1306-5p [PMC10064547]. In a study investigating the relationship between EPB41L4A-AS1 expression and inflammatory factors, LPS was used to simulate an inflammatory reaction in T2DM [PMC7829128]. EPB41L4A-AS1 was also identified as a risky lncRNA in ovarian cancer [PMC6365949]. Transfection with EPB41L4A-AS1 and VDAC1 resulted in a significant decrease in cell numbers, which was rescued by transfection with the HIF-1α plasmid [PMC6838551]. Additionally, EPB41L4A-AS1 overexpression downregulated HIF-1α expression and led to a decrease in HK2 levels [PMC6838551]. Correlation analysis revealed that EPB41L4A-AS1 exerted a strong positive regulatory effect on 55 PCGs in 13 brain regions [PMC8579638]. Knockdown of EPB41L4A-AS1 triggered glycolysis through the VHL/HIF-1α pathway [PMC6444057]. Flow cytometry analysis confirmed similar results after overexpression of EPB41L4A-AS1 for 72 hours [PMC6838551]. Furthermore, multi-univariate analysis showed that high expression levels of EPB41L4A-AS1 were associated with poor overall survival in cancer patients [PMC10064547]. Finally, HTR8-S/Vneo (HTR8) cells were used as a model to study the biological role of EPB41L4A-AS1 in miscarriage placental tissue [PMC6838551].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUCGGGUCCCAAAAUACGUGGUCUAAAGUCCUUUGGGCUCCUGCCGCUGCCAGCACUGAUCAUAUGCUCUUGACCCUGGUCGGGUGGGGGGAUGUCUGGAUACCUCCUCUGUGGAAAGAACUGGCCACACAUCCGCAGAGGUGACUCGGGCUGAGAACCCAGGCUCCUCCUCCCUUUGGUGACACGCCCCUCGGUCCCUCACUGGCACUUCUCCCUCCGGCCACACGGCGGCGUCUCGCCAUAGCGCAGCGGCCGAUGGUACAGCCCGCUCCCCCCUCGCGCUCUCGGACAGUGGGUCCUUCCACUUGUAGAAAAGCAUUGUGGGACGGAAGCCUGUCCUUUCUUCCUUUUGGUGCGAGCUUGCUGUGGUUUUUGCUCUGGGUCCUCUGGGAUGGCGCCUGGCUGUGGCCGCGUGGUCUCUCACGCAGGGGCGCCGGGCGGGGGAACGCGGCCACCCUGAGUCUGGUGAGUCGACUGCGGCGGCCUGUGUCCGAAGUGUCCGGGGCCGUGAACAAGGGCAGCGGCCUGGCCUCAGGCCUGCGUUCCCACGUUUGGAAACGGGGAGCUUCGUCGAUUUGUGUUUACAUCAUCGACUAUGCCAGGGAGUUCUCCAGAUAAGCCUGGUUUUAUUUUCGUCAGUGAAAAGGCCUUACCGUAUAACUGACUUUAUGCUUGCCCUGCCCCCGUAUAAAAUAACUUAAAAGCAGCGUGCCUGGUUACAGCUGUUUCCACGUGCGGUGCUCGUCGGGAGUGAUCACCUACCCUACAGGUGGAAGAUGGAUGCCUGAAGUGUAGACUGCUGCUAGCUGAAUACCAUCUGGGAGCAUAAAGGUGACCUGAAGGAUGUCCUUGGUGAGGAUUUUGAAAAUUUGAUCUUCACAAGAGUUGCCUGGAUCAUUUGAAAUUUCUGGGAGUCUGAGGAGUACUGACAUAAUUACCUGCUGGAGUCUGUAAAUACACAUUUAAGACAGUGAGGAUGUGAAUAAAUAUAUUAAUGCACUUUGGCAUUUGUGUUUUAAGUGAUUAACUGCCAGAAACAGCUAUUUCUAAAAAGUUAUAAGGGAGGAGGGGUUCUUUUUUGAUCAGUAUUCACUGCUGUCACCAUAAUUAAUAGCCUUAAAAUAGCUUGUGUUUGGCCCAAAGAGAAAUGUACUUUCUUCCAGUGACUCAAAAAUCGUGGCUAGAACUAGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications