Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-543 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-543 precursor URS000075CC43_9606

  • 78 nucleotides
  • 7 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, miRBase, RefSeq)
  • Found in 14 species

Automated summary: This pre miRNA sequence is 78 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (Ensembl/GENCODE, RefSeq, Ensembl, ENA, GeneCards, HGNC, miRBase). Described in 33 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-543 precursor sequence is a product of mir-543 precursor, hsa-mir-543 precursor, mir-543 precurso, mir-543, MIR543 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACUUAAUGAGAAGUUGCCCGUGUUUUUUUCGCUUUAUUUGUGACGAAACAUUCGCGGUGCACUUCUUUUUCAGUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Colobus angolensis palliatus microRNA 543
    3. Dasypus novemcinctus (nine-banded armadillo) microRNA 543
    4. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 543
    5. Lynx canadensis (Canada lynx) microRNA 543
    6. Mustela putorius furo (Domestic ferret) miRNA
    7. Pan paniscus (bonobo) miRNA
    8. Panthera leo (lion) microRNA 543
    9. Panthera pardus microRNA 543
    10. Panthera tigris altaica (Tiger) miRNA
    11. Pongo abelii miRNA
    12. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-543 precursor
    13. Rhinopithecus bieti miRNA
    14. Rhinopithecus roxellana microRNA 543
    15. Tupaia belangeri microRNA 543
    2D structure New