Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3646 precursor URS000075CAFA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3646: Hsa-mir-3646 is a microRNA that has been studied in various contexts. In an in silico analysis, it was found that the A allele (rs1062577) generates a new miRNA binding site for hsa-mir-3646, hsa-miR-3662, and hsa-miR-5585-3p [PMC5628818]. Hsa-mir-3646 was identified as one of the under-expressed microRNAs that were altered at least four-fold [PMC3440352]. It was also found to have 122 target genes in a coexpression network analysis [PMC9461120]. Hsa-mir-3646 is one of the most prevalent microRNAs along with hsa-miR-144, hsa-miR-3662, and hsa-miR-12136 [PMC9461120]. In the context of colorectal cancer, it has been studied along with other microRNAs such as miR-155 and miR-143 [PMC7962059]. Additionally, there is a significant negative correlation across ten cell types for hsa-mir-3646 [PMC3804285]. Overall, these studies highlight the importance of hsa-mir-3646 in various biological processes and its potential role in disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAGUAGGUUGGGUUCAUUUCAUUUUCAUGACAACCCUAUAUGGGAAAAUGUUGUGAAAAUGAAAUGAGCCCAGCCCAUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications