v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SPART antisense RNA 1 (SPART-AS1) URS000075CAAB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SPART-AS1: SPART-AS1 is a long non-coding RNA (lncRNA) that has been identified as one of the key genes within a new minimal critical region for psychomotor delay [PMC8471443]. This region contains a total of 36 genes, including SPART-AS1, as well as ALG5, CCDC169, CCDC169-SOHLH2, CCNA1, COG6, CSNK1A1L, DCLK1, ELF1, EXOSC8, FOXO1, FREM2, KBTBD6, KBTBD7, LHFPL6, MAB21L1, MRPS31, MTRF1, NAA16, NBEA, NHLRC3, POSTN, PROSER, RFXAP, RGCC, SERTM, SLC25A15, SMAD9, SOHLH2, STOML3, SUPT20H, TRPC4, UFM, VWA8, and WBP4 [PMC8471443]. SPART-AS1 has also been identified as one of the seven differentially expressed lncRNAs that can act as an independent prognostic signature for clear cell renal cell carcinoma (ccRCC) [PMC10082204]. In terms of co-expression with OS-related genes (genes associated with overall survival), SPART-AS1 is found to co-express with three genes: CNKN3, RAD51, and TIMP1 [PMC10082204]. Furthermore, multifactorial Cox regression analysis has shown that SPART-AS1 is one of the seven OS-associated lncRNAs that can be used to construct a predictive signature for ccRCC [PMC10082204].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGGCCGCGCGGCCCCGCCCGUCGGCCUCGCUCCCGCCACAGAGCCCGCAGCACGCCGCCGCCGCAGCCUAGGUCACAGAUCUGUGAAAAUCUUUAAAGGCAUGUGUUUUGCCAUAUAUGCAAGUGAAUCAACUUGCCAGAUAAAAGUUUGCUGCCUAAAUAUGAUUACUAGGAAAGCCAAGUCUCUCUUCCUGGAUUUCUUCUCCUAUAAACCGCCUAUUGAUACCUACCCACUUCUCUAUGGAGCACAGAUGAAGGAUAUUGGUCAUCUCCAGCAUCUAGCACAACGUCUGCAAUGGAACAGGCGAGCUGUGAAUAUUUGUGGAAUGCAUGGGUGGACUAAAGACCUAUCACCUCACUCUAGAAUGCCCAGCAUGUUGGAGCAUGUUAAGCACUAUAUGAGCUGCUGAGGAUACAGGAAUAAACAACAACACAGGUGUGUCCUCUGCCCAAACCAGGCAUAAAUGAGCUUCCAAAUGAACACAAACAAAUCUGGAAGGCUUUUGAGGAAGAAGGACCAUUAAAAAAGCUGCUGACGACUGCCUGGAAUCUGGUUUGGAGCAUCUCCAAAGCCAACGUACUUUCCCCCAAGAAAAUACAGGAAGAUCUCUCUGCCCAGGCUUGGAAAUACAUAAGGAUCAGGUUUGCCAUCCUCUACUUUAGGGUGACUUUAACAUAAUUUAAUGCCCACUGACUGCUUUUCUCCUACAGGUAAAGUAACAAACAAAGGAGUCAACUCUCAGGAGCUCUCUCUUUCAUCUGCUUUAUGUUGCCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications