v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Prolemur simus (greater bamboo lemur) microRNA 1296 (ENSPSMG00000016832.1) URS000075CA1B_1328070

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCUACCUAACUGGGUUAGGGCCCUGGCUCCAUCUCCUUUAGGAAAACCUUCUGUGGGGAGUGGGGCUUCGACCCUAACCCAGGUGGGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 1296 (ENSANAG00000009727.1)
  2. Carlito syrichta (Philippine tarsier) microRNA 1296 (ENSTSYG00000021839.2)
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 1296 (ENSCCAG00000000165.1)
  4. Cercocebus atys microRNA 1296 (ENSCATG00000018387.1)
  5. Colobus angolensis palliatus miRNA (ENSCANG00000001782.1)
  6. Gorilla gorilla gorilla microRNA 1296 (ENSGGOG00000034184.2)
  7. Homo sapiens microRNA hsa-mir-1296 precursor
  8. Macaca nemestrina (Pig-tailed macaque) microRNA 1296 (ENSMNEG00000022494.1)
  9. Mandrillus leucophaeus (Drill) microRNA 1296 (ENSMLEG00000016338.1)
  10. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1296 (ENSNLEG00000021804.2)
  11. Pan paniscus (bonobo) microRNA 1296 (ENSPPAG00000010189.1)
  12. Pan troglodytes ptr-mir-1296 (ENSPTRG00000034739.2)
  13. Pongo abelii miRNA
  14. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1296 precursor
  15. Rhinopithecus bieti microRNA 1296 (ENSRBIG00000015854.1)
  16. Rhinopithecus roxellana microRNA 1296 (ENSRROG00000026166.1)
  17. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 1296 (ENSSBOG00000004364.1)
 Publications