v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) inactivation escape 1 (INE1) URS000075C6CE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

INE1: INE1 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases [PMC6456668]. It has been shown to be involved in the regulation of hsa-miR-155-5p [PMC9354660]. INE1 is part of a prognostic signature for disease-free survival in cervical cancer, with higher expression levels associated with shorter survival [PMC8457683]. It is also considered a potential hotspot for neurogenetic disorders [PMC6456668]. INE1, along with two other lncRNAs (AC008760.1 and MKNK1-AS1), has been identified as an autophagy-associated lncRNA and a candidate for a prognostic signature in cancer [PMC8148478]. In prostate cancer, INE1 is part of a risk score formula that predicts patient outcomes, with higher expression levels associated with adverse prognosis [PMC8148478]. In the context of co-expression and ceRNA networks, INE1 has been found to be significantly associated with overall survival in various cancers [PMC7897818]. Additionally, INE1 has been identified as one of the upregulated genes specific to TK-MTX treatment in primary central nervous system lymphoma (PCNSL) [PMC7242340]. Overall, these findings highlight the potential importance of INE1 as a biomarker and therapeutic target in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUUUAUUUCAUUUAUUCACCAGAUAGUUUUAGUACUGUUUUAGGUAUUGGGGAUAUACCAAGGAAUAAAACAAGAUUCCUGGAGGGAGAGGGGAACGGACAGCAAACAAUAGACACAAUACGAUCGUGAGGUAUAUAGUUAAUGUUGGUGAUGAGUGCUCCUCAAAGGAAACAACUAAAACCAGACAAGGGAAGUCGGGGUGUCAGGGAGAAUGGUUUGUAGUAUUGAUGACAAUGGUUAAGGAAGGCCUGAGUUCUGCAAAGACCUCAAGGAUAUGAGGGACUAGAGUGCCCUCUGCUGUGGAAGAGCCUGCGCAAAGAUCCUGAGGUGGGAGGGGUCAGGGAGCCAACUCAUUUUACGGUAAGUGGAGGUGGGAUCCAGGGGAGGAUUCUGAGCAGAGGAGGGACGUGGCCCAAUUUGGGCUUUGAAAGGAUCCUGCUUGUCUGUGUGCCAGCAUCCUGGUGGUGGUUGGGGGAGUCUGCAUCAAUCCUGGGUGCUGUUACCUGAAAAAAUAGCAGGUGUUAGACGAAAGAACAGAUGUCUGGCCCAUUGUCUCCAGUCUGUUCCUGUCCACAGCUUCCCUUUAUGCUGAGCCCCUGCCACAUGCAUCAUCAUCCUGGCCAUGUGGCAUUGUCACAGACCGUCUCUCCUGCUAGCCUCCUAACUCAGGGCCUGGGUCUUCCCCAGCAUUAAGUAAAUCAGUCUCAGGCAGACAGCCCUUUAUAGGUGUUUGGGCCAGGUGCGGUGGCUCACGCCUGUAAUCCCAGCUCUUUGUGGGGCCGAGGUCUUUGAGCUCAGGAGUUCAAGACCAGCCUGGGCAGCAUGACAAAACCCUGUCUCUACCAAAAAUACAAAAAUUAGCCACGCAUGGUGGCACACACCUGUGGUCCCAGCUACUCGGGAGGCUGAGGUGGGAGGAUCGCUGGAGCCUGGGAAGUUGAGGCUGCAGUGAGCCGUGAUCAUGCCACUGCAUUCCAGCCUGUGUGAUGGAGAGAGACCCUGUCUCAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications