Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-588 precursor URS000075C40E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-588: Hsa-mir-588 is a microRNA that has been found to have binding sites in circN4BP2L2 and is associated with various biological processes and diseases, including lung squamous cell cancer, COVID-19, MI, and glioma [PMC8721970] [PMC10067640] [PMC7700842] [PMC5041942]. It has been identified as a potential regulator of GRN in lung squamous cell cancer, affecting cell migration and invasion [PMC8721970]. Hsa-mir-588 has also been found to target ACE2 in COVID-19 and MI, suggesting its involvement in the pathogenesis of these diseases [PMC7700842]. In glioma, hsa-mir-588 is associated with the regulation of dysfunctional pathways and malignant progression [PMC5041942]. Additionally, hsa-mir-588 has been implicated as a tumor suppressor gene in colon cancer through its binding to SUCLG2 and SUCLG2P2 [PMC8475515]. It has also been identified as one of the key miRNAs associated with a lower overall survival rate in various cancers including breast cancer [PMC8544338]. Furthermore, hsa-mir-588 has shown negative correlations with CYB561 expression in breast cancer, suggesting its potential role as an inhibitor of breast cancer progression or predictor of better prognosis [PMC8722309]. Overall, hsa-mir-588 is a versatile microRNA that plays important roles in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUAGGUACCAAUUUGGCCACAAUGGGUUAGAACACUAUUCCAUUGUGUUCUUACCCACCAUGGCCAAAAUUGGGCCUAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications