v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) NUP50 divergent transcript (NUP50-DT) URS000075C062_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

NUP50-DT: NUP50-DT is a long non-coding RNA (lncRNA) that has been identified as part of a prognostic signature for diffuse large B-cell lymphoma (DLBCL) [PMC8776467]. It has also been found to co-exist with gene alterations in IL-15 mutations [PMC9712805]. In a study on kidney renal clear cell carcinoma (KIRC), the expression levels of NUP50-DT were found to be lower in KIRC samples compared to normal samples [PMC9360495]. NUP50-DT, along with three other AAG-related lncRNAs (AC093278.2, NNT-AS1, and CYTOR), was used to construct a prognostic signature for KIRC patients [PMC9360495]. The high expression of AC093278.2 and NNT-AS1, as well as the low expression of CYTOR and NUP50-DT, were associated with better overall survival in the KIRC dataset [PMC9360495]. The forward and reverse primers for NUP50-DT were also provided in the study [PMC9360495]. Overall, NUP50-DT is an lncRNA that has been implicated in DLBCL prognosis and gene alterations in IL-15 mutations. In KIRC, its expression levels are lower compared to normal samples and its expression level is associated with overall survival. It was used along with other AAG-related lncRNAs to construct a prognostic signature for KIRC patients.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGCCGCGCUUUGGGGCGUCGGCUCACGUGGGGCCGGCAACGCGUCUUCCAGGAUGUUCGCGCGCUAGUCGCCGCUGAGGGGCCGGCGAUGCGCGAGGAGUUCCGGCGAGGAAGGUCGGUCAGUGGACAUGGCCGAGGCCCGCGGUGUCCGCGUGUGGGAGCUGCAGGGCUGAGGAGAGGCCGCCCGCAACCCUCGGGAAUCGUAGACGAGGUCUCACUAUGUUGGCCAGGUUGGUCUCGAAUUCCUGGCCGCAAGCCGUUCUCCAGUCUGGGCCUCCCAAAGUGCUAGGAUUACAGGAACAGAAUUGCCAUUGGGCCCAGGGAGAGACUACACUUCUUGUCUGCUUUGUUGCUAGUGCGGCCUUGUGGCCAAGCACAGAACGUGUGCAGUGAUGAUGGUGCAACUUCUAGGUCGUCCCCAGCAUGGAAAAUGAGCCCUGGGCAUGGAAGAUGAGCCCUGGUCCUGCAGCGGUGCUCUUUCCUCUUCUCACAAGCUGGAAUGUGCAUGUGCUCCCACCCAGCUUUGACCAUGGGGCGAAAACAGUACUCUGCAGUCUGGCAGAGCAACAAGGUGGAAAGGGCCUGGGUCCUUGAGUGACGUCAUGAGCCCUCUCACUGUCCCGACUUUGGGACUGUUAUAUGAUAAGGACUUUCUGUGAGUCACUGUCUUUUAGAGUCUCUCUGUUUUAGCUGCCUGGACUUUAUCCUGAAUAAUAUGGCUGUUAUCAUGGGUAUAGUGUUACUAUGAGCCUCAUCUAAGUAAUUUCUACUCUGCCUUUGACCACUAAACUCAUGUUGGACAAGAGUCACUUAGCAUUAUUUUUUCCUCAAUGAAGAGGUUAAGAUGGAGGGAGCAGGAGAAAUUGAGGCCUGUGUUUUACCAGAAGGUGAAGGGCUGUCUUUGCCUUUCCUACAUUUAUGAAGGAUAAUUCUAGACAAAAACAUUAAGUUCAUAUCAAACCAUCUGCUUUGUGAAGCCAUGGGCUUUGCUAGAACUUUCUGUGACAUGACAUUUAUUAACCCGAGUCUACCUGGAAGUUAGAGCUGAGGAAGUUUUCCUAGAGUGGAAAAAGUCCAAUGCACUUGUAAAAGUCAGACCAAGCUCAGCUCAGAUUUCAGUUUUAUUAGAAGUAUGUCACCUUCCUGAGCCCUUAUUAUUUCCCCAUCUGUGAAAUGAGGACACCGUUCUCUCUUUCUAAGCAUUGCUGGGAAGACCACACACCACUGAGACAGAAGGUGGGGCUAGCGCAGUUCUGGGCAUUUUGUACACCCCCAACAAAUACUGAUUUAUUUCCUUCUUUUUCCUUGCUCAGAAAAAAUUGGAGAAGGCUUUAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications