v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (Pig-tailed macaque) microRNA 6501 (ENSMNEG00000009296.1) URS000075BDAA_9545

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAGUUGCCAGGGCUGCCUUUGGUGACAGCAGCAGUAGAGUUGCCAGAGCAGCCUGCGGUAACAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 6501 (ENSANAG00000001790.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA 6501 (ENSCJAG00000042072.2)
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 6501 (ENSCCAG00000003529.1)
  4. Cercocebus atys microRNA 6501 (ENSCATG00000009438.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 6501 (ENSCSAG00000026470.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000006896.1)
  7. Gorilla gorilla gorilla microRNA 6501 (ENSGGOG00000043653.1)
  8. Homo sapiens microRNA hsa-mir-6501 precursor
  9. Macaca fascicularis microRNA 6501 (ENSMFAG00000009783.2)
  10. Macaca mulatta microRNA 6501 (ENSMMUG00000041549.2)
  11. Mandrillus leucophaeus (Drill) microRNA 6501 (ENSMLEG00000003841.1)
  12. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 6501 (ENSNLEG00000034757.1)
  13. Pan paniscus (bonobo) microRNA 6501 (ENSPPAG00000005346.1)
  14. Pan troglodytes miRNA (ENSPTRG00000046249.1, ENSPTRG00000052126.1)
  15. Papio anubis microRNA 6501 (ENSPANG00000003270.3)
  16. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000009849.1)
  17. Pongo abelii microRNA 6501 (ENSPPYG00000036948.1)
  18. Rhinopithecus roxellana microRNA 6501 (ENSRROG00000009782.1)
  19. Theropithecus gelada (gelada) microRNA 6501 (ENSTGEG00000026913.1)