v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HIF1A antisense RNA 2 (HIF1A-AS2) URS000075BB37_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HIF1A-AS2: HIF1A-AS2 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases, including renal carcinoma [PMC8185866], osteosarcoma [PMC8290460], kidney carcinomas [PMC8185866], atherosclerosis [PMC7584671], breast cancer [PMC7918432], and lung cancer [PMC8411487]. It has been shown to interact with miR-129-5p and miR-30a-5p to regulate gene expression in osteosarcoma and renal carcinoma cells respectively, affecting cell proliferation and invasion [PMC8290460]. HIF1A-AS2 has also been found to promote inflammation in atherosclerosis [PMC7584671] and regulate trophoblast cell migration and invasion in trophoblasts cells [PMC8450180]. In addition, HIF1A-AS2 has been associated with cisplatin resistance in bladder cancer and osimertinib resistance in lung cancer, but the underlying molecular mechanisms are not yet fully understood [PMC8517096]. Furthermore, HIF1A-AS2 expression levels have been found to be increased in non-small cell lung cancer (NSCLC) tissues compared to normal tissues [PMC7457835]. It has also been shown that HIF1A-AS2 interacts with IGFBP2 and DHX9, which are required for HMGA1 expression [PMC8640553]. Moreover, overexpression of HIF1A-AS2 has been shown to promote the proliferation, migration, and invasion abilities of hepatocellular carcinoma cells [PMC8517096]. Additionally, HIF1A-AS2 expression levels have been found to be increased in coronary artery disease (CAD) patients [PMC8147832]. Finally, high expression of HIF1A-AS2 has been associated with lower 5-year survival rates in certain cancers [PMC8411487].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUCCUCCAUUGUAAGAUAAAAAGAGCUACCUAAGAGAUCUGUGGCUCAGUUCCUUUUGUUCAGUAUAUAUACCUCAGGGUAAAGGACCUAAGGCUCUGGCACUUCCUACAUAAUUUGUUCAUAAAAAUAAUUUUCUGUACCUGUAGGUGCAGGGAUUCAUAGUGAUUUUUCUGUUUUAAAAAAUAUCUUUCUACACUGUCUGAUUUUUAAAAAUGAGAUUAUCAGUAUAAAAGAAAUACAGCUAUUUUGUAAAAGAAAAAUACAGGAGAAAAAGGAUAAAGCUACUUUGUUUUAAAACGCAGUAUCAUUAAAACAAAAACAAACCAAAUUUGUUCUAAGUUUGACUUUAGAGUCAGGAAACUUAAGCUUACAUUUUUGGUCUGCCAUCUAUUACUUUUAAAGCUUGGGCAAAUUAUUCAUUUGAAGUCUAAAUUUAUUAAUCUGUUAAUGGGAACAGAUUAGAAAUCUUCAGAGAAGCUCUAGCCUUUGUAACAUUGUGACUAUAAUGCUGAGAACUGCUUCACUCAUCCCAUUCAUAUUUUAAAAAUACUAAUAUUUUGUGUUUGAGCAUUUUAAUAGGCUCAGAAACUUAAAAAUGAUGUUUCUUUUCUAACAACAUACUCUUUUCAAUGGGAUAUUAUGGUUGUUAUUAUUUAACAUGACAUUUAGGGACUCAACAUACAUUAAGGUGAUGGCACUAAGAUAAAUGUAGAAAUAACCAGUACCAUGUAAUUUUCAUAAGUGCUUAAAUUGUUGGUAAACAAUUUUAUGAGUUGGAGGUGUUGAAGCAAAUAUUAUUAAUAUUUGAACAUAAAAGCUGAUCAAAGGGGCCUGGUCCACAGAAGAUGUUUAUUUGAUGUAACAAAACAAUACAGUUAGUGUUAGAUCCAACCACAAAGAGCAAAAGGAAUGAAAAAUUUGUACAAUGUACAUAGAAAAAACAAGAUAUUUACUGUGACAACUAUAUAUUCCUAAAAUAAUGCUUCUAAAAUUACUCAAUUAUUGAAAUCUACAUGAAAAAAAGGAUGUUAAUAGCGACAAAGUGCAUAAAAUCAAACAUUGUAUUUUGAGCAAAUUAACAUACUAGGCAAUUUUGCUAAGAAUGCAUGAUUUUUUUUUUCUUGUUUACAGUCUGCUCAAAAUAUCUUUAUACCAACAGGGUAGGCAGAACAUUUAGGUUUAAUAUCAGUUACACAAUAUUAGCAUAAACUUCCACAACUACAUAGGGUAUUGUUUUCUUUUGAGCUGGCAAAGUGACUAUAGAAACAUCAGAUGAUUUCUCUGAAUUGAGAAUUUUAUCCAAAUAAAUGCCACAUACCUUCUAGAUAUAUGCAUAUCUUUCUAUAUUAUGUAAAUGGCUUUACCCAUUUAAAUAAUAAACCAUACAGCAUUUAAGAAUCAUUAUUAUAUGAUUAACAAUGUCAUGUUCCAGGUUUAACAAUUUCAUAGGCCAAAAAAAAUUUCUUCUUAAAAACUAGUUUUAUAAACGCAGAAUAUAUUCCAUGAGUAACUGCUGGUAUUUUUUAAGAAAAUAUAUUGUGCAAUUGUGGCUACCACGUACUGCUGGCAAAGCAUUAUUAUUUAUGUAAAAUGUGAAAAAAAAGGUGUAAAAAUUUUUCAACUGCCUAUGAUCAUGAUGAAAGGUUACUGCCUUCUUACAAAAAUUAUAUUGGCAUCUUCUUAAAAAUAAUUCGAAAAAGGGAUAAACUCCCUAGCCAAAAAUAAAUAAAUAAAAAGGUGCAUUUUUUAAAAUGAUGCUACUGCAAUGCAAUGGUUUAAAUACCAAAAAACUGAGAAAAUGAGCUGUCUGUGAUCCAGCAUUAAAGAACAUACUAAAAAAGAGCAUUAAUGUAAAUUAAGUAGAAAGGGGAUCAAAAUUGAACUAACCAAGUUUGUGCAGUAUUGUAGCCAGGCUUCUAAAAUUAGAUGUAGAAAAUAUAAAUAGACUGCUUUAGGUAAUGAGCCACCAGUGUCCAAAAAAAGGAAUGAAAUUAAGAAAAAGCUCAGUUAACUUGAUCCAAAGCUCUGAGUAAUUCUUCACCCUGCAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications