Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1229-3p URS000075BB29_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1229: Hsa-mir-1229 is a microRNA that has been linked to Colorectal Carcinoma [PMC8137704]. It is one of several miRNAs that show differential expression in various conditions, including hsa-mir-6784, hsa-mir-4707, hsa-mir-647, hsa-mir-3652, hsa-mir-6757, hsa-mir-1-1, hsa-mir-3671, hsa-mir-6505, and hsa-mir-LeT7F1 [PMC8137704]. Hsa-mir-1229 has been identified as a suitable biomarker for colon cancers [PMC4822961]. It is involved in regulating the expression of AD-related gene SORL1 and other targeted genes related to nervous system development and neurological disease [PMC7047416]. Hsa_mir_1229 also targets the circRNA Hsa_circ_0000745 along with other microRNAs such as hsa_mIR_136 and has_mIR_1273 [PMC8483823]. In a study comparing kidney tissues of healthy individuals with those of DN patients, differential expression of 67 miRNAs was observed. Among these miRNAs were upregulated ones such as has_miR_135b and downregulated ones such as has_miR_1229 [PMC8616647]. Overall, these findings highlight the involvement of hsa_mIR_1229 in various biological processes and its potential as a biomarker for different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUCACCACUGCCCUCCCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications