v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Python bivittatus (Burmese python) pbv-miR-122-3p URS000075BAE6_176946

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACGCCAUUAUCACACUAAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Anolis carolinensis aca-miR-122-3p
  2. Cavia porcellus cpo-miR-122-3p
  3. Columba livia cli-miR-122-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-122-3p
  5. Gallus gallus gga-miR-122-3p
  6. Homo sapiens hsa-miR-122-3p
  7. Mus musculus Mus_musculus piRNA piR-mmu-50356477
  8. Oryctolagus cuniculus (rabbit) ocu-miR-122-3p
  9. Salmo salar ssa-miR-122-2-3p