Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-934 URS000075BA4B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-934: Hsa-mir-934 is a microRNA that has been found to be significantly deregulated in gastric cancer (GC) based on H. pylori infection status [PMC8900545]. It is one of the top 10 miRNAs that are highly enriched in NanoPoms preparation [PMC9253007]. The A allele of SNP rs73558572 causes a mismatch in the secondary structure of hsa-mir-934 [PMC9111935]. In a study on colorectal cancer cells, hsa-mir-934 was found to have elevated expression levels >4-fold compared to control cells [PMC4121995]. Hsa-mir-934 has also been identified as one of the miRNAs associated with epithelial-mesenchymal transition (EMT) in gastric cancer [PMC7308588]. Additionally, hsa-mir-934 is one of the m7G-related miRNAs associated with the survival of uterine corpus endometrial carcinoma (UCEC) patients [PMC9713471]. Overall, hsa-mir-934 has been implicated in various cancer-related processes and may have potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCUACUACUGGAGACACUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-934
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-934
Publications