v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) KTN1 antisense RNA 1 (KTN1-AS1) URS000075BA48_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

KTN1-AS1: To investigate the biological functions of KTN1-AS1 in GBM cells, KTN1-AS1 was upregulated in A172 cells by transfecting KTN1-AS1 overexpression plasmids and silenced in U251 cells by transfecting KTN1-AS1 siRNAs [PMC9904930]. The subcellular localization of KTN1-AS1 was explored in T98G glioma cells, specifically the nuclear and cytoplasmic fractions [PMC7640367]. KTN1-AS1 is located on human chromosome 14q22.3 and is one of three lncRNA signatures derived from the Atlas of ncRNA in cancer (TANRIC) database for predicting the survival of patients with head and neck squamous cell carcinoma [PMC9684558]. It is suggested that KTN1-AS1 may play oncogenic roles by upregulating oncogenes through mediating miR-505 [PMC9904930]. Additionally, KTN1-AS1 was found to sponge miR-23b to suppress its expression in non-small cell lung cancer (NSCLC) cells [PMC7244022]. The correlation between KTN1-AS1 and miR-505-3p or MMP-9 expression was determined using Pearson's rank correlation test [PMC7640367].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGCUCCGGUACUCGCUGCUCGCGGCUGGCCGGCUCGGGAUUCCGGGCUUUCUUCCCGAGACCGCGUCCCCCAGCUGGGCCGAAGGUGGACGCUCAGGGGCUGGAGGCUCAGCGGAAUCCCCUGCGUUCAGUAGCCCCGCUCUCCCCUGUCCCGAAGGAUUACUCUGCCCCUCAGCGGUUCCAGUGCCCUCAAAGCAAUCUGUCUCUGAAGUACUGGCUAUCUUCUGAGCGUGUGCCAGAAGAUCCAGCUUUGUUGAAAAGCGAAGCCGUUAGUCCCUUAAUACAAAGGAUCAGGGAUAGCAGAAAUGAAAGUAUAAUGGAAGCAGCUGGAGGAUUCCAGGUCCACUUUCACCCAAGUAAUGGAGACGGAAGGUUCAUCGAAACUUCUUCAGCUGCAGAUCUAGAAGUCAUUAGCUAUUCUAGCAAAGUAUCUGUCACAGAAAGGUGCUUCAUAAAGGUCUGCACUGUGCUCUUUUGACCUGUGUCUUCAAGCAUGUGCUGUCAUAACAGAUUAAAGAUGACUGAAAAUUAUCUGCCACUCAUUGCGUGAAAGGUGGGAUCUGUAGACCUCCCUCUUGAAUUUGGGAGGGUUCUGUGACUGCUGUGACCAAUGAAUAUGGCAGAAGUGACGCUUUGCCAACUUCUGGGUCCAGGCUAUACGAGACAGGCAGUUCCACUCACUGUCUCUUAGAUCCAUGUAAAAAGUUCAUCUACCCUGCUGGAAAAACCAUGUAGAGAGGCCCUGAGACUACAUUGGGUGGGAGAGGGGCUCAGCUGCACCAUCUUCCAACUGUCCCCAUCAAGAUGACAGAAAUAUAAAUGAAGCCUUCUUGAACUCCAGACCAUCCAUGCUACAAGCUAAAUGCCACCAAGCGACCCCAGUUAAUACCAUGUGGAGCAAAAAUAUCACUUAACCAAGCACUGCCUGAGUUUCUGACCCCACAGAAUUCUGACCCCAUACAAAUAAAAUAAUUUUUGUAAUUUUUUAUAAUUCGUCAUGUAAUAGAUAAAUGGAACAGCCUUCUUCCAGUCUUUUAAAUAGCUGCAAGAAAUCUUAUUCAAGCAGAAGGAAGUUUCUACUUUGUUCAUACAGUCUCAAGACAUCCCUGGAGCCUUUCAAGGGAAAUUUGGGCAGAAGUAGGUAGAGAGGUAAAGCUAUUAUGUAACAUUACUUAACAUGAUUAAAACCACCUUAAUGUCUCCCAUCCUCAAAGGCUGCCAGUGAAUUGGAAAUUAAUGGAUUAAAUGAGGACAGAGAAACUAGUAUUUGUGCAUAUGCACUGUGCCAGGUAUUUAACGUAUCUUAGCUCAUGUGGUCUUCGAAACAACCCCAUAUUGUAGUAUCAGGCUCACACGGGUAACUAACUAGUGCAAAGACACAAGGCUCACAAACUGCUACUUGACCCUAGAGCUCUUUGACUCCGAUUCCCAUGUACGUGCCCCAAUACCAUGUUGACUCCCAAGGUGUAAAUCUUCAGGUAUACAAACUAUUAAAAUGUGAAUUUUCAUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications