Rhinolophus ferrumequinum (greater horseshoe bat) miRNA (ENSRFEG00010002613.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rhinolophus ferrumequinum (greater horseshoe bat) miRNA (ENSRFEG00010002613.1) URS000075B905_59479

79 nucleotides
1 database (Ensembl)
Found in 9 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CCCACACCUUUUCCUCUUCUUCUUGGCCGGGUUGGCUCCGCCAGCUCCCCCCGAGGAGGACGAGGAGGAGGAGGAAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Balaenoptera musculus miRNA (ENSBMSG00010008138.1)
Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021768.1, ENSCGRG00001007049.1, ENSCGRG00015037162.1)
Mesocricetus auratus (Golden Hamster) microRNA 1895 (ENSMAUG00000001992.1)
Microtus ochrogaster (vole) microRNA 1895 (ENSMOCG00000009843.1)
Mus caroli microRNA 1895 (MGP_CAROLIEiJ_G0007842.1)
Mus musculus microRNA mmu-mir-1895 precursor
Mus spretus (algerian mouse) microRNA 1895 (MGP_SPRETEiJ_G0008237.1)
Physeter catodon (sperm whale) miRNA (ENSPCTG00005021557.1)
Rattus norvegicus (Norway rat) microRNA 1895 (ENSRNOG00000041792.2)