Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-3473e URS000075B8DD_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-3473e: Mmu-mir-3473e is a type of microRNA that is regulated by NONMMUT145297.1 [PMC7339411]. It has been found to be upregulated in the DNCB 14 days group [PMC8698818]. In scrapie-infected mice, mmu-mir-3473e was the most significantly upregulated miRNA in the 139A, ME7, and S15 groups [PMC5148024]. It is part of a family of miRNAs that also includes mmu-miR-3473a and mmu-miR-3473b, which are also increased in scrapie-infected mouse models [PMC5148024]. In addition, mmu-mir-3473e has been found to be downregulated in certain conditions such as MSCs incubated with nanoparticles [PMC7720507]. It has also been identified as an early-response miRNA along with mmu-miR-1931 and mmu-miR-5128 [PMC6829453]. Furthermore, mmu-mir-3473e is targeted by circRNA_3832 (mmu_circ_0009625) along with other miRNAs such as mmu-miR-344i and mmu-miR-1892 [PMC7331745]. References: [PMC7339411] [PMC8698818] [PMC5148024] [PMC7720507] [PMC6829453] [PMC7331745]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCUGGAGAGAUGGCUCGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications