Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-5787 precursor URS000075B8AF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5787: Hsa-mir-5787 is a microRNA (miRNA) that has been identified in various studies as having significant expression levels in different biological contexts. It has been found to be highly expressed in comparisons between T-M and H:T-M, as well as between BM-M and H:BM-M [PMC8139033]. Furthermore, hsa-mir-5787 has been implicated in interactions with AD-related neurofibrillary pathology and BCAS4/SHISA7 [PMC8899724]. It has also been identified as a target of lnc-FAM72D and lnc-EPC1-4, with implications for hepatocellular carcinoma (HCC) [PMC7343450]. In addition, hsa-mir-5787 has been found to be differentially expressed in apigenin-treated cells compared to control cells [PMC8095173]. The miRNA hsa-mir-5787 is consistently identified as one of the top miRNAs in various analyses, along with other miRNAs such as hsa-miR-4763-3p, hsa-miR-149-3p, hsa-miR-762, and hsa-miR-6791-5p [PMC5002491]. It has also been implicated in the regulation of circ-RANBP9 and LAMA2 for precision treatment [PMC8039645]. Hsa-mir-5787 is predicted to interact with several other miRNAs such as hsa-miR-4739, hsa-miR6195p, and hsa-miR78513p [PMC8806466]. Furthermore, it has been shown to inhibit cell growth by targeting eukaryotic translation initiation factor 5 (EIF5) [PMC9028476], regulate inflammation mediated by macrophages through TLR4/NF-kappaB signaling [PMC9436632], and be involved in ceRNA regulation networks [PMC6151003]. Overall, hsa-mir-5787 is a miRNA that has been consistently identified in various studies and has implications in different biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGCUGGGGCGCGGGGAGGUGCUAGGUCGGCCUCGGCUCCCGCGCCGCACCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications