Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) microRNA ssc-mir-133b precursor URS000075B813_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-133b: Ssc-mir-133b is a microRNA that has been studied in relation to its effects on Mcl-1 3'-UTR and tooth development [PMC6131536]. In a study, it was found that inhibiting ssc-mir-133b led to a significant restoration of luciferase activity in the wild-type Mcl-1 3'-UTR, but no significant change was observed in the mutant Mcl-1 3'-UTR [PMC6131536]. Additionally, in an animal study, it was observed that overexpression of ssc-mir-133b in tooth germs resulted in the failure of premolar formation [PMC6131536]. These findings suggest that ssc-mir-133b plays a role in regulating Mcl-1 3'-UTR activity and tooth development [PMC6131536]. Further research is needed to fully understand the mechanisms by which ssc-mir-133b affects these processes [PMC6131536].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCUCUGGCUGGUCAAACGGAACCAAGUCCGUCUUCCUGAGAGGUUUGGUCCCCUUCAACCAGCUAUAGCAGGGCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species