Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-613 URS000075B7E4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-613: Hsa-mir-613 is a microRNA that has been studied in various contexts [PMC2703952]. In multiple sclerosis (MS), hsa-mir-613 was found to be upregulated in peripheral blood, along with hsa-miR-142-3p and hsa-miR-140-5p, while hsa-miR-107 was downregulated [PMC9191563]. In non-small cell lung cancer (NSCLC), hsa-mir-613 was identified as a potential biomarker for radiosensitivity, along with other microRNAs [PMC8433590]. Hsa-mir-613 is predicted to regulate a similar set of target genes as hsa-miR-1, according to the miRecords database [PMC2703952]. It is involved in a negative autoregulatory feedback loop with SREBP-1c and LXRE to regulate LXRα [PMC3192659]. However, the concentrations of hsa-mir-613 were too low to be analyzed in certain contexts [PMC3942699]. Hsa-mir-613 is negatively regulated by multiple mRNAs, including ARPC1A, C5orf51, CORO1C, ELMO1, KCNJ2, NANP, OSTF1, PGD, SH3BGRL3, SPRED1, TSPAN4, and UST [PMC9191563]. Overall, hsa-mir-613 has been found to be upregulated in MS peripheral blood and NSCLC radiosensitivity and plays a role in regulating LXRα [PMC9191563][PMC8433590][PMC3192659].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAUGUUCCUUCUUUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-613
Publications