Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-103 precursor (mmu-mir-103-1) secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-103 precursor (mmu-mir-103-1) URS000075B775_10090

Automated summary: This pre miRNA sequence is 86 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl/GENCODE, Ensembl, ENA, miRBase, MGI, RefSeq). Described in 30 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-103, RF00129). Mus musculus (house mouse) microRNA mmu-mir-103 precursor (mmu-mir-103-1) sequence is a product of 103-1, 1, ENSMUSG00000065553.3, mmu-mir-103-1 precursor, mir-103-1 precurso, mir-103-1 precursor, Mir103-1, mir-103-1 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCUUACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUGAGAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Cavia aperea (Brazilian guinea pig) microRNA 103a-1 (ENSCAPG00000001692.1)
    2. Cavia porcellus microRNA 103a-1 (ENSCPOG00000016232.3)
    3. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020831.1)
    4. Chlorocebus sabaeus miRNA (ENSCSAG00000020122.1)
    5. Cricetulus griseus miRNA (ENSCGRG00000021234.1, ENSCGRG00001004011.1, ENSCGRG00015021886.1)
    6. Dasypus novemcinctus miRNA (ENSDNOG00000027838.1)
    7. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003228.1)
    8. Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00000022249.1, ENSHGLG00100024273.1)
    9. Jaculus jaculus miRNA (ENSJJAG00000003491.1)
    10. Loxodonta africana (African savanna elephant) microRNA 103a-1 (ENSLAFG00000024229.1)
    11. Mesocricetus auratus miRNA (ENSMAUG00000005290.1)
    12. Microtus ochrogaster (vole) microRNA 103-1 (ENSMOCG00000003371.1)
    13. Mus caroli microRNA 103-1 (MGP_CAROLIEiJ_G0007092.1)
    14. Mus pahari (Shrew mouse) microRNA 103-1 (MGP_PahariEiJ_G0006812.1)
    15. Mus spicilegus (steppe mouse) miRNA (ENSMSIG00000007512.1)
    16. Mus spretus microRNA 103-1 (MGP_SPRETEiJ_G0007434.1)
    17. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000017980.1)
    18. Octodon degus miRNA (ENSODEG00000022057.1)
    19. Otolemur garnettii miRNA (ENSOGAG00000017334.1)
    20. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 103-1 (ENSPEMG00000002383.2)
    21. Pongo abelii microRNA 103a-1 (ENSPPYG00000021231.1)
    22. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000017203.1)
    23. Pteropus vampyrus miRNA (ENSPVAG00000024577.1)
    24. Rattus norvegicus microRNA rno-mir-103 precursor (rno-mir-103-1)
    2D structure New