Pan troglodytes (chimpanzee) microRNA 4700 (ENSPTRG00000041291.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) microRNA 4700 (ENSPTRG00000041291.2) URS000075B578_9598

74 nucleotides
2 databases (ENA, Ensembl)
Found in 3 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCAGUGAGGUCUGGGGAUGAGGACAGUGUGUCCUGAAAUUCACAGGACUGACUCCUCACCCCAGUGCACGAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Homo sapiens microRNA hsa-mir-4700 precursor
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 4700 (ENSNLEG00000033613.1)
Pan paniscus (bonobo) microRNA 4700 (ENSPPAG00000008538.1)

Publications