Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548m precursor URS000075B476_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548m: Hsa-mir-548m is a microRNA (miRNA) that shows biased expression between women and men and is defined as a Female-specific miRNA (FmiR) [PMC6076379]. In a study, miRNAs predicted for specific genes were identified, including hsa-mir-548m for the PCK1 gene [PMC7807343]. Additionally, hsa-mir-548m was found to be upregulated in both HIV-1 and HIV-2 infected cells [PMC4885076]. Hsa-mir-548m was also identified as one of the miRNAs that hsa_circRNA_001481 functions as a sponge for, along with hsa-miR-1252-5p and hsa-miR-4644, to regulate the expression level of EMB [PMC9296062]. Hsa_circRNA_001481 was predicted to inhibit the expression level of hsa-mir-548m and other miRNAs such as hsa-miR-1252-5p and hsa-miR-4644, while promoting the expression of target genes [PMC9296062]. POU2AF1 and AMMECR1 genes were found to be common targets between hsa-miR-1252-5p and hsa_mir_6758_5p, as well as between hsa_mir_1252_5p and has_mir_548m [PMC9296062]. Furthermore, it was observed that HSA_circRNA_001481 significantly reduced the expression of has_mir_548m along with other miRNAs such as has_miR_1252_5p and has_miR4644 compared to controls [PMC9296062]. Bioinformatics analysis revealed that HSA_circRNA_001481 has binding sites for miRNAs including has_miR_548m [PMC9296062].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAUUAGGUUGGUGCAAAGGUAUUUGUGGUUUUUGUCAUUAAAGUAAUGCAAAAGCCACAAAUACCUUUGCACCAACCUAAUAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications