Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-595 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-595 precursor URS000075B3FD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-595: Hsa-mir-595 is a microRNA that is part of the TGFβ signaling pathway [PMC9319258]. In a study comparing different types of mesenchymal stem cells (MSCs), it was found that the expression of hsa-mir-595, along with hsa-miR-122-5p and hsa-miR-576-3p, was weakly altered in M-MSCs compared to AF-MSCs, but strongly upregulated in L-MSCs [PMC9319258]. Additionally, the analysis of miRNAs revealed that hsa-mir-595 was one of the five miRNAs that were downregulated in the study, along with hsa-miR-636, hsa-miR-939, hsa-miR-720, and hsa-miR-623 [PMC4222092]. On the other hand, eight miRNAs were found to be upregulated: hsa-miR-338-3p, hsa-miR-342-3p, hsa-miR-30b, has-miR30c, hsa-miR-27a, hsa-miR-27b, hsa-miR-374a, and hsa-miR-92a [PMC4222092]. These findings suggest that there are distinct expression patterns of miRNAs in different types of MSCs and that there may be specific roles for these miRNAs in regulating cellular processes [PMC9319258] [PMC4222092]. Further research is needed to fully understand the functional significance of these findings and their potential implications for MSC-based therapies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGGAAGCCUGCACGCAUUUAACACCAGCACGCUCAAUGUAGUCUUGUAAGGAACAGGUUGAAGUGUGCCGUGGUGUGUCUGGAGGAAGCGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications