Mus pahari (Shrew mouse) predicted gene, 24321 (MGP_PahariEiJ_G0007689.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus pahari (Shrew mouse) predicted gene, 24321 (MGP_PahariEiJ_G0007689.1) URS000075B309_10093

80 nucleotides
1 database (Ensembl)
Found in 8 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUGAUACCGAAAAGGGGUUCACCGAGCAACAUUCGUCCUCCAGAUGCAAAGUUGCUCGGGUAACCUCUCUCCGAGUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Cricetulus griseus (Chinese hamster) microRNA mir-409 (ENSCGRG00015014286.2)
Meriones unguiculatus miRNA (ENSMUGG00000017820.1)
Mus caroli predicted gene, 24321 (MGP_CAROLIEiJ_G0007299.1)
Mus musculus (mouse) predicted gene, 54371 (ENSMUSG00002075156.1)
Mus spicilegus (steppe mouse) miRNA (ENSMSIG00000007643.1)
Mus spretus (algerian mouse) predicted gene, 24321 (MGP_SPRETEiJ_G0007643.1)
Peromyscus maniculatus bairdii (Northern American deer mouse) predicted gene, 24321 (ENSPEMG00000001088.2)
Rattus norvegicus (Norway rat) microRNA rno-mir-409b precursor

2D structure