Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3681 precursor URS000075B2FC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3681: Hsa-mir-3681 is a microRNA derived from an LTR element and located on the p arm of human chromosome 2 [PMC7398795]. Although it has not been extensively studied, dysregulation of hsa-mir-3681 has been reported in human disease and cancer, with downregulation observed in cervical cancer [PMC7398795]. The seed region of hsa-mir-3681-5p is 5′-AGUGGAU-3′ [PMC7398795]. The enhancer activity of hsa-mir-3681 has been shown to be associated with VNTRs (Variable Number Tandem Repeats) [PMC7398795]. In luciferase assays, the presence of hsa-mir-3681 mimic and hsa-mir-3681-5p inhibitor resulted in upregulation of luciferase activity [PMC7398795]. Interestingly, when used together, the enhancer activity was enhanced even more compared to when only the hsa-mir-3681 mimic was used alone [PMC7398795]. The enhancer activity of SHISA7, with three and six 9-mer hsa-mir-3681 binding regions, was found to be in cooperation with transcription factors (TFs) based on examination using TRANSFAC v8.0 [PMC7398795]. Hsa-mir-3681 overlaps with LTR16D1 [PMC7398795]. Further studies are needed to confirm whether the enhancer activity observed is contributed by VNTRs or TFs [PMC7398795]. In conclusion, miRNA can affect VNTR by repressing its activity; however, in rare cases, VNTRs can gain enhancer activity by blocking hsa-mir-3681 mimics using a hsa-miR‑368‑3p inhibitor [PMC7398795]. The enhancer activity of hsa-mir-3681-5p binding primers was observed in the presence of hsa-mir-3681 mimic treatment [PMC7398795].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUUCCAGUAGUGGAUGAUGCACUCUGUGCAGGGCCAACUGUGCACACAGUGCUUCAUCCACUACUGGAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 3681 (ENSGGOG00000042797.1)
Publications