Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis let-7c-1 stem-loop (ami-let-7c-1) URS000075B2B8_8496

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUGCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Anas platyrhynchos (mallard) microRNA let-7c (ENSAPLG00020000793.1)
  2. Anas platyrhynchos platyrhynchos (common mallard) microRNA let-7c (ENSAPLG00000000319.2)
  3. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000011371.1)
  4. Anser brachyrhynchus miRNA (ENSABRG00000009137.1)
  5. Anser cygnoides miRNA (ENSACDG00005009991.1)
  6. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000001490.1)
  7. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020821.1)
  8. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000014784.1)
  9. Cricetulus griseus (Chinese hamster) microRNA let-7c-1 (ENSCGRG00000021229.1, ENSCGRG00001003895.1)
  10. Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000016032.1)
  11. Ictidomys tridecemlineatus miRNA (ENSSTOG00000016790.1)
  12. Jaculus jaculus miRNA (ENSJJAG00000003400.1)
  13. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000005214.1)
  14. Microtus ochrogaster (vole) microRNA let7c-1 (ENSMOCG00000009168.1)
  15. Mus musculus let-7c-1 stem-loop (mmu-let-7c-1)
  16. Mus pahari microRNA let7c-1 (MGP_PahariEiJ_G0006766.1)
  17. Mus spretus (algerian mouse) microRNA let7c-1 (MGP_SPRETEiJ_G0007885.1)
  18. Nannospalax galili miRNA (ENSNGAG00000004713.1)
  19. Nothoprocta perdicaria miRNA (ENSNPEG00000015850.1)
  20. Ochotona princeps miRNA (ENSOPRG00000017437.1)
  21. Octodon degus miRNA (ENSODEG00000022050.1)
  22. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017291.1)
  23. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025629.1)
  24. Rattus norvegicus let-7c-1 stem-loop (rno-let-7c-1)
  25. Sorex araneus miRNA (ENSSARG00000016673.1)
  26. Tupaia belangeri miRNA (ENSTBEG00000017871.1)
  27. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000023994.1)
  28. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016057.1)