v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 930 (LINC00930) URS000075B26A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00930: LINC00930 is a long non-coding RNA (lncRNA) that has been found to play a role in regulating gene expression. Experimental evidence has shown that LINC00930 physically interacts with two proteins, RBBP5 and GCN5, suggesting its involvement in protein-protein interactions [PMC8867671]. Additionally, the use of pharmacological inhibitors of histone methylation and acetylation has been shown to reduce the luciferase activity of PFKFB3, a gene that LINC00930 is believed to regulate [PMC8867671]. Knockdown of LINC00930 has also been found to decrease the levels of H3K4me3 and H3K9ac, two histone modifications associated with gene activation, at the promoter region of PFKFB3 [PMC8867671]. Furthermore, analysis of cancer tissues from the TCGA HNSC dataset has revealed that the expression level of LINC00930 is significantly increased in cancer tissues compared to adjacent non-tumor tissues [PMC8867671]. To investigate its role in gene regulation further, siRNAs targeting LINC00930 and other proteins involved in its interactions (PFKFB3, RBBP5, GCN5) were used [PMC8867671]. Overall, these findings suggest that LINC00930 may function as a regulatory RNA molecule involved in protein-protein interactions and histone modifications to regulate gene expression. Further research is needed to fully understand its mechanisms and potential implications in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUUCCCACUGACUCAGAUGCUGAGGGGCCAGACUGAAGGGACAGUGGCCAUUGCAUCAAGUCAGAGAACGGAUCUGACCCAUCUAGUAGAAGCUUAUUGUUUUGGCAGAAGCACAAGCUCUUAGAGGUGCAGCUGCAGGGUGUGACCUAUUGGGGACAUUGAGCUCAGUGACCAUGGGCCCUGAGAGUCUGAAAUCCUGGAAUUUCUCCCAAAACGAAGUCCAUGUAGGGAAGCCAAAGUGUGAGUCUUACCCGGCUGGUUUACAACUGACUGACAUUUGCUGCCUGGGCAGCUGUUGUGGGUGCCUGGAAACCCUAUUGGACUAGGACUGGCCCCGGCAAAAAACAAGUGUUAUAGCUGCCCAGUGUCCUCUGAGUGGAUGCUGGUGAUUCUGGUAUGGAGCCCAGAUGUAAGGCAGCAGGUGGUCCAGAAGGCACCAGAAGAGGUCUCCUGUCAAAGUCAGGGCCAGAGAAGAAGGCACAGGGAACCUACUGCACGAGACUUUCACUUGCAACGAGCAACCCAUGAUGAGGAGGGAGGAUUCCUGGGGGCAUUGAGUCCCCCAGACACAAGGACCCAAGACCUUCUUGCUUGGAAAGUGAAUUCCUCAGAAUUCCGAGAUGAUGCCAGUCUUGGAGGAAGAUGACAUGAGGACCCAAAACCUUCUUGCUUGGAAAGUGAAUUCCUGAGAAUUCCGAGAUGAUGCCAGUCUUGGAGAAAGAUGACAUGAGGACCCAAAACCUUCUUGCUUGGAAAGUGAAUUCCUCAAAACUCCACAAAGACUCCAGUCUUGGAGGAAGAUGACAUGAGGACCCAAAACCUUCUUGCUUGGAAAGUGAAUUCCUCAGAACUCCACGAAGACUCCAGUCUUGGAGGAAGACGAGGUGUUGAGAGAUAGCUGGGAUCCCUGAGGAAGGCAGCCCCAGUCUCCGGUGGAGAAUUAAGAGGGGCCCAAGCAGAUGGUUGGUGGUGGAAACGUCACCUCAGUAUAGUACUAUGGAGUUUCCUUUCACCCCCAACAGCCGACGGUUUCCAGGGGCGAAGAGUGAAAAUUGAAGCAAGGUGUCUACUGUCCAGCGGUAGACAAGGAGGCAGUGCGCCUGCCACCCCCAAGGAAGAGUCAGUUCAGAAGCACAGCAGCUGCUGGAAACCCAGGAGGUUUCCAGUUCGUUCCUGCUGGGACCUGGCAAGAACUGCACUGUCAAGGCUGCAAGAGGCUCCUGACGGCUUCUGACAUGUACAGAAUGGAAUAAGAGAACCUAGCAGAAAUGGAAGCAGAGGCAAGAGGUCUGGAGGCCAGGAAAAUGUCAAUGGAAAGCAGCUAGCAUGAAGACCCCACAGUGUUCCUCCCUCUAGUAGUCUGGUAUUAUUUGGAGCUGAGAUGCUCCCAAUAUGGUUGGGACAUUUGUCCCCUCCAAAUCUCAUGUGAGAAUUUGAUCCCCCAUUUUGGGGAUGGGGUCUAAUGGGAGGAGUUUGGGUCAUGACGGGGGACCCCUCAAGAAUGGCUUUGUGCCCUGCUCACCAGGAAUGAAUGAGCUCUCACUCUACUAGUUCACUGGAGAGCUGGUUUUUUAAAGAGCCUGGCGUCUCCCCAACUUUCUCUCUUGCUCCCCCUUCUCACUGUGUGAUAUACCUGCUCCCCUUUGCCAUCCAUCAUGAGUGGAAGCUUCUUGAAGCCUCCACCUAAAGCAGAUGCCGACACUAUGCUUCCUGCACAGCCUGCCAUACCAUGAGCCAAUAAACCUGUUUUCUUUGUAAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications