v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1230 (LINC01230) URS000075B229_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01230: LINC01230 is a long intergenic noncoding RNA (lncRNA) that has been shown to be transcriptionally upregulated by PPARĪ³ activation, reducing endothelial dysfunction and affecting AKT phosphorylation [PMC7499433]. However, there is limited knowledge about the role of LINC01230 in carcinogenesis [PMC8966281]. In a study analyzing the expression of lncRNA sequences in endometrial cancer (EC) patients, including LINC01230, no statistically significant differences in expression were found between EC patients and controls [PMC8966281]. In another study, alterations in LINC01230 were observed in the DMRT3 alteration group [PMC9777283]. Additionally, LINC01230 was found to be closely related to the prognosis of lung adenocarcinoma (LUAD) and was highly expressed in LUAD cells and tissues [PMC10061461]. However, further research is needed to fully understand the role of LINC01230 in carcinogenesis and its potential as a prognostic marker for EC and LUAD.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUGCAGCAGUUUUAAAAUUUCGAACUAGUUCAAGAGCUGCUCGGCUGCUCGUUUACUUUCAGUUUUGGGAACAGAGGCUUACACCCCUUUCUCCUCCUGUUUCUCCUCCAGUCCCUCUUCCCCUCAAUCUAGUUUCCCAAAGUUAGCAAACCUACUUUCUUGAUUUUGUUUCUUAACAUUUAAAACAACUGGUGAAGGGCUAAUGAUUUCAUCUCCUUACCACCACCCCUAACCUUAAAAGCAAUAAAUAAAAUAAAAGCCCAGCCUGCCAACCGCAUGCACACACGGCCAGCGGUGGUGGGGGUUUGUAGUUUGCAUACACGUCGCGGGGCAGAAGCCUGUUUGCAAAGGCUGAAAUGUAGCUAGCAGGGGAAGACGCUGAAAAAACAGAGUGAUUUGAUAAAAACGUGCUGGGCCCUGUUACAGGAGGGCUGCUGGGAGUAGUCCCAGGUACUCACAUCAGAAGGGGUGCAGGGGAAUAAAAUUUAAAAAAGCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications